View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12985_low_9 (Length: 337)
Name: NF12985_low_9
Description: NF12985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12985_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 11 - 320
Target Start/End: Complemental strand, 35051670 - 35051361
Alignment:
| Q |
11 |
atcatcaccatagtcaacaagttttagtgtatttacagagccatccaaaccaacattacttgcttccattctataaacatagctatatgatgaaaaatcc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35051670 |
atcatcaccatagtcaacaagttttagtgtatttacagagccatccaaaccaacattacttgcttccattctataaacatagctatgtgatgaaaaatcc |
35051571 |
T |
|
| Q |
111 |
tttgaaatcaacctctctttgatccatgatctttctccatcttgttgaggaaacatgaaaccagaaactagcctaacacaacctggttcatcttcatttc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35051570 |
tttgaaatcaacctctctttgatccatgatctttctccatcttgttgaggaaacatgaaaccagaaactagcctaacacaacctggttcatcttcatttc |
35051471 |
T |
|
| Q |
211 |
cagctaaggtagtgcatctttctaccattggcatccattgaggaagtttcttagtttgtgagactatgttccaaactttgtcaataggtgcacaaattat |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35051470 |
cagctaaggtagtgcatctttctaccattggcatccattgaggaagtttcttagtttgtgagactatgttccaaactttgtcaataggtgcacaaattat |
35051371 |
T |
|
| Q |
311 |
accataaact |
320 |
Q |
| |
|
|||||||||| |
|
|
| T |
35051370 |
accataaact |
35051361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University