View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12987_high_17 (Length: 240)
Name: NF12987_high_17
Description: NF12987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12987_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 228
Target Start/End: Complemental strand, 34688436 - 34688226
Alignment:
| Q |
18 |
caaacaggtgacaagagcacgatcataataccaggatggcaatccatgagctatttttcggatgtgtcgaacatatgttggtttcttgaggcagagtttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34688436 |
caaacaggtgacaagagcacgatcataataccaggatggcaatccatgagctatttttcggatgtgtcgaacatatgttggtttcttgaggcagagtttg |
34688337 |
T |
 |
| Q |
118 |
caaaggaggtagtgaggttgcacagagtggtcgggaatgcagtcacagaaggacgtcacattgttgtagggacaggttcctctcaactttttcttgctgc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34688336 |
caaaggaggtagtgaggttgcacagagtggtcgggaatgcagtcacagaaggacgtcacattgttgtagggacaggttcctctcaactttttcttgctgc |
34688237 |
T |
 |
| Q |
218 |
actctctgctc |
228 |
Q |
| |
|
||||| ||||| |
|
|
| T |
34688236 |
actctatgctc |
34688226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 27 - 202
Target Start/End: Complemental strand, 43614605 - 43614430
Alignment:
| Q |
27 |
gacaagagcacgatcataataccaggatggcaatccatgagctatttttcggatgtgtcgaacatatgttggtttcttgaggcagagtttgcaaaggagg |
126 |
Q |
| |
|
||||||| ||| || |||||||||||||||||||| ||||| |||||||| ||| | | ||| ||||||||||||||| |||| ||| ||||||| | |
|
|
| T |
43614605 |
gacaagaccacaataataataccaggatggcaatctatgagttatttttctgatccaacaagcatttgttggtttcttgagccagaattttcaaaggaag |
43614506 |
T |
 |
| Q |
127 |
tagtgaggttgcacagagtggtcgggaatgcagtcacagaaggacgtcacattgttgtagggacaggttcctctca |
202 |
Q |
| |
|
|||||||||| || | ||||| || |||||||| ||| |||| || ||| ||||||| || |||||||| ||||| |
|
|
| T |
43614505 |
tagtgaggttacataatgtggttggaaatgcagtaacacaaggtcgacacgttgttgttggaacaggttcatctca |
43614430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University