View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12987_low_14 (Length: 338)
Name: NF12987_low_14
Description: NF12987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12987_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 319
Target Start/End: Original strand, 6917160 - 6917488
Alignment:
| Q |
1 |
acggcggcgacagtgaagtctccgttgaaccgccttcattagtcaaagctcg-------ccattgacagcaccccgagtttcccatggacacgctcagag |
93 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
6917160 |
acggcggcgacagtgaagtctccgccaaaccgccttcattagtcaaagctcgagcagcgccattgacagcacgccgagtttcccacagacacgctcagag |
6917259 |
T |
|
| Q |
94 |
attgatcctgaagccgcagcagtttgagacgagtccgctcccgtatctggcaatcagtttgagctgtgctgtgctcgtggaagcctagccgcccaggaga |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
6917260 |
attgatcctgaagccgcagcagtttgagacgagtctgctcccgtatctggcaaacagtttgagctgtgccatgctcgtggaagcgtagccacccaggaga |
6917359 |
T |
|
| Q |
194 |
--ccgcccaagaatt-atctgaagccgtgttcgttcccggcaacagttgagcccaacgagaacacacaccagttctgcaacaggaaacaggtactatccg |
290 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6917360 |
ggccgcccaagaattgatctgaagccgtgttcgttcccggcaacagttgagcccaacgagaacacacaccagttctgcaacagggaacaggtactatccg |
6917459 |
T |
|
| Q |
291 |
gagacgagtttgaagccgggagcacttcg |
319 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6917460 |
gagacgagtttgaagccgggagcacttcg |
6917488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University