View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12988_high_23 (Length: 266)
Name: NF12988_high_23
Description: NF12988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12988_high_23 |
 |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0008 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 61518 - 61748
Alignment:
| Q |
1 |
ttaggcataccaataaaagaatatttgtcattaaatttgatnnnnnnnnnggtcacacatgcacacaaatagacctcgtttactaaaacttgcgttagac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
61518 |
ttaggcataccaataaaagaatatttgtcattaaatttgataaacaaaaaggtcacacatgcacacaaatagacctcgtttactaaaacttgcgttagac |
61617 |
T |
 |
| Q |
101 |
ctcaactacttttgataattattgagacggccctgtttgtggtacgacattttggtgcccagcggtatgttcctgtattctgtcatgtagcagctctttg |
200 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||| ||||||||||| |||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
61618 |
ctcaactacttttgagagttattgagacggccctgtttgtggtacgtcattttggtgctcagcagtttgttcctgtattctgtcatgtagcagctctttg |
61717 |
T |
 |
| Q |
201 |
gtgcgtttcttgcttgcggggctgactggtt |
231 |
Q |
| |
|
| | |||| ||||||||||| ||| |||||| |
|
|
| T |
61718 |
gcgtgttttttgcttgcgggactggctggtt |
61748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University