View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12988_high_24 (Length: 264)
Name: NF12988_high_24
Description: NF12988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12988_high_24 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 52 - 264
Target Start/End: Original strand, 40473066 - 40473278
Alignment:
| Q |
52 |
aattgatgtacaaacaccacatattctttaactatgttcataaatctggcagatggtgttctttgaagttggaaggcataaaattatgttcctgaaactc |
151 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40473066 |
aattgatgtacaaacaccacatattcttttactatgttcataaatctggcagatggtgttcttcgaagttggaaggcataaaattatgttcctgaaactc |
40473165 |
T |
 |
| Q |
152 |
tcaagtcttaacaacagaattcaaatcaagagactgtaactgaactattttttgttccaggctcaagcctttatcttggaacttttatcctttaaatata |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40473166 |
tcaagtcttaacaacagaattcaaatcaagagactgtaacttaactattttttggtccaggctcaagccttcatcttggaacttttatcctttaaatata |
40473265 |
T |
 |
| Q |
252 |
taatcttgatggt |
264 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40473266 |
taatcttgatggt |
40473278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University