View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12988_high_27 (Length: 251)
Name: NF12988_high_27
Description: NF12988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12988_high_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 5 - 236
Target Start/End: Complemental strand, 34819571 - 34819340
Alignment:
| Q |
5 |
ttggaggaccagttgaaggaatctcgcaactccttaaagacgacaaaggatgagaaaaagaaagtcgaggaagataagcgagatgttgaagccaagtgct |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34819571 |
ttggaggaccagttgaaggaatctcgcaactccttaaagacgacaaaggatgagaaaaagaaagtcgaggaagataagcgagatgttgaagccaagtgct |
34819472 |
T |
 |
| Q |
105 |
tggagcttaataacaatgatggtgccataaagggggaggttaagaaggacgttgagaagattatcgagttgcaagagggtgttgaaaatgcaaagaaagg |
204 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34819471 |
tggagcttaataacaattatggtgccataaagggggaggttaagaaggatgttcagaagattatcgagtttcaagagggtgttgaaaatgcaaagaaagg |
34819372 |
T |
 |
| Q |
205 |
gtggttgggaatatggaaaagggggaggttga |
236 |
Q |
| |
|
||||||| |||||||||||||||||| ||||| |
|
|
| T |
34819371 |
gtggttgcgaatatggaaaagggggaagttga |
34819340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University