View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12988_low_20 (Length: 302)
Name: NF12988_low_20
Description: NF12988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12988_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 85; Significance: 2e-40; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 68 - 160
Target Start/End: Complemental strand, 34257983 - 34257891
Alignment:
| Q |
68 |
aaaattagatttctgaatagaagaaaattcacaaccatgccaacaaaattttgtattacataatttatacacatatttcacaatacaagcctt |
160 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34257983 |
aaaataagatttctcaatagaagaaaattcacaaccatgccaacaaaattttgtattacataatttatacacatatttcacaatacaagcctt |
34257891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 214 - 289
Target Start/End: Complemental strand, 34257891 - 34257816
Alignment:
| Q |
214 |
tagacaaaaagcagcttagctaagtttgagtcacttatatacattgtttatatacataattcactagacctatgct |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34257891 |
tagacaaaaagcagcttagctaagtttgagtcacttatatacattgtttatatacataattcactagacctatgct |
34257816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 166 - 236
Target Start/End: Complemental strand, 34257844 - 34257774
Alignment:
| Q |
166 |
ttatatacataattcacttgagcaatgcttgttgctatttcaaaaccatagacaaaaagcagcttagctaa |
236 |
Q |
| |
|
|||||||||||||||||| || | |||||||||||| ||||||||||||| ||| ||||||||| |||||| |
|
|
| T |
34257844 |
ttatatacataattcactagacctatgcttgttgctctttcaaaaccataaacacaaagcagctaagctaa |
34257774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 21 - 61
Target Start/End: Complemental strand, 34258119 - 34258079
Alignment:
| Q |
21 |
agcactagcaccaaatagacctatcagtttccattttccaa |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34258119 |
agcactagcaccaaatagacctatcagtttccattttccaa |
34258079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University