View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12988_low_22 (Length: 278)
Name: NF12988_low_22
Description: NF12988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12988_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 18 - 266
Target Start/End: Original strand, 44547694 - 44547942
Alignment:
| Q |
18 |
agtaatagcattcaacttgttgtgtttgcaattgcattgctataactttaataagtttatttgtctacgcttatgtgaagttactgttttcactttgaat |
117 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44547694 |
agtaatagcatacaacttgttgtgtttgcaattgcattgctataactttaataagtttatttgtctatgcttatgtgaagttactgttttcactttgaat |
44547793 |
T |
 |
| Q |
118 |
atggatcagttcaaaccactttgaaaatgtgatgcaacaattttcccaattgggacgaatactggctttgttattttgaaattttgcaactgagatatgt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44547794 |
atggatcagttcaaaccactttgaaaatgtgatgcaacaattttcccaattgggacggatactggctttgttattttgaaattttgcaactgagatatgt |
44547893 |
T |
 |
| Q |
218 |
gcttcatgttgtagatcttctaaaggaattagaagcagctcgtgatgat |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44547894 |
gcttcatgttgtagatcttctaaaggaattagaagcagctcgtgatgat |
44547942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University