View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12988_low_28 (Length: 251)

Name: NF12988_low_28
Description: NF12988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12988_low_28
NF12988_low_28
[»] chr6 (1 HSPs)
chr6 (5-236)||(34819340-34819571)


Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 5 - 236
Target Start/End: Complemental strand, 34819571 - 34819340
Alignment:
5 ttggaggaccagttgaaggaatctcgcaactccttaaagacgacaaaggatgagaaaaagaaagtcgaggaagataagcgagatgttgaagccaagtgct 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34819571 ttggaggaccagttgaaggaatctcgcaactccttaaagacgacaaaggatgagaaaaagaaagtcgaggaagataagcgagatgttgaagccaagtgct 34819472  T
105 tggagcttaataacaatgatggtgccataaagggggaggttaagaaggacgttgagaagattatcgagttgcaagagggtgttgaaaatgcaaagaaagg 204  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |||||||||||||||| |||||||||||||||||||||||||||||    
34819471 tggagcttaataacaattatggtgccataaagggggaggttaagaaggatgttcagaagattatcgagtttcaagagggtgttgaaaatgcaaagaaagg 34819372  T
205 gtggttgggaatatggaaaagggggaggttga 236  Q
    ||||||| |||||||||||||||||| |||||    
34819371 gtggttgcgaatatggaaaagggggaagttga 34819340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University