View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12988_low_30 (Length: 241)
Name: NF12988_low_30
Description: NF12988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12988_low_30 |
 |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0008 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 19 - 225
Target Start/End: Original strand, 61080 - 61287
Alignment:
| Q |
19 |
ttggctgccctgcaacatgggacctggagcaccaaactcagtttaaaagccttttgagctgtggtagaaaggttggcgaaaa-ctacacatgatttggtt |
117 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
61080 |
ttggctgccctgcagcatgggacctggagcaccaaactcagtttaaaagccttttgagctgtggtagaaaggttggcgaaaaactacacatgatttggtt |
61179 |
T |
 |
| Q |
118 |
ctcaaatgtttaggtagttcggaaagctagaaataatatgaccttctcccagaaaggttttgatcgggagaaggttgtagaagatgccaaaattttatct |
217 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
61180 |
ctcaaatgtttaggtagtttggaaagctagaaataatatgaccttctcccaaaaaggtttcgatcgggagaaggttgtagaagatgccaaaattttatct |
61279 |
T |
 |
| Q |
218 |
ttaaattt |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
61280 |
ttaaattt |
61287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University