View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12988_low_34 (Length: 226)

Name: NF12988_low_34
Description: NF12988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12988_low_34
NF12988_low_34
[»] chr3 (2 HSPs)
chr3 (20-107)||(6997864-6997951)
chr3 (168-204)||(6998013-6998049)


Alignment Details
Target: chr3 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 20 - 107
Target Start/End: Original strand, 6997864 - 6997951
Alignment:
20 accagctcaataaggaatttctaatcttcatgtgcctctattcgcaaatttctaatttttaatcttcatgtgactcttaactaccctc 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6997864 accagctcaataaggaatttctaatcttcatgtgcctctattcgcaaatttctaatttttaatcttcatgtgactcttaactaccctc 6997951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 168 - 204
Target Start/End: Original strand, 6998013 - 6998049
Alignment:
168 aataccagatggcgaagaacgaagctatcatggaaat 204  Q
    |||||||||||||||||||||||||||||||||||||    
6998013 aataccagatggcgaagaacgaagctatcatggaaat 6998049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University