View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12988_low_34 (Length: 226)
Name: NF12988_low_34
Description: NF12988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12988_low_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 20 - 107
Target Start/End: Original strand, 6997864 - 6997951
Alignment:
| Q |
20 |
accagctcaataaggaatttctaatcttcatgtgcctctattcgcaaatttctaatttttaatcttcatgtgactcttaactaccctc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6997864 |
accagctcaataaggaatttctaatcttcatgtgcctctattcgcaaatttctaatttttaatcttcatgtgactcttaactaccctc |
6997951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 168 - 204
Target Start/End: Original strand, 6998013 - 6998049
Alignment:
| Q |
168 |
aataccagatggcgaagaacgaagctatcatggaaat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6998013 |
aataccagatggcgaagaacgaagctatcatggaaat |
6998049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University