View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12988_low_36 (Length: 207)
Name: NF12988_low_36
Description: NF12988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12988_low_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 4332443 - 4332243
Alignment:
| Q |
1 |
atcaacgtctatgttcatatcaggatccaagtcctcaaaaggaatctgaggactgtgcaattcttcggtgtcagaactgtctgaatgtgaatcaatatta |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4332443 |
atcagcgtctatgttcatatcaggatccaagtcatcaaaaggaacctgaggactgtgcaattcttcggtgtcagaactgtctgaatgtgaatcaatatta |
4332344 |
T |
|
| Q |
101 |
aacaaatcttcatcagaaaaggaacttgttggggaagacatgggtgaagttgtctgagcgagatttttgtatttggaactaactcttcccttacttgctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4332343 |
aacaaatcttcatcagaaaaggaacttgttggggaagacatgggtgaagttgtctgagcgagatttttgtatttggaactaactcttcccttacttgctg |
4332244 |
T |
|
| Q |
201 |
c |
201 |
Q |
| |
|
| |
|
|
| T |
4332243 |
c |
4332243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University