View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12989_high_2 (Length: 241)
Name: NF12989_high_2
Description: NF12989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12989_high_2 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 3 - 241
Target Start/End: Original strand, 6916944 - 6917182
Alignment:
| Q |
3 |
atcatggcaggcttcttgtatattgttccggtctggccaaaagggcggccatatccaagtcctttcaacaatttggagttcattgattcattctgaatta |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6916944 |
atcatggcaggcttcttgtatattgttccggtctggccaaaagggcgaccatatccaagtcctttcaacaatttggagttcattgattcattctgaatta |
6917043 |
T |
 |
| Q |
103 |
tcaccttcacaaagctaaggtttagaaacagtcacacagtgacagacgcagcaatgttcctctgaatctcaataggcagaagaactgttggaagaaaatt |
202 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917044 |
tcaccttcacaaagctaaggtctagaaacagtcacacagtgacagacgcagcaatgttcctctgaatctcaataggcagaagaactgttggaagaaaatt |
6917143 |
T |
 |
| Q |
203 |
cagtttagcatcattcacggcggcgacagtgaagtctcc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917144 |
cagtttagcatcattcacggcggcgacagtgaagtctcc |
6917182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University