View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1298_low_12 (Length: 202)
Name: NF1298_low_12
Description: NF1298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1298_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 81; Significance: 2e-38; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 2e-38
Query Start/End: Original strand, 11 - 115
Target Start/End: Original strand, 1787835 - 1787939
Alignment:
| Q |
11 |
gtttgttcagttttagtttgttcgagtcttttcagatctcaggtgcatacgtcaaatgtagtcttaatccgaagagctatgtttttcattggtaaaagtt |
110 |
Q |
| |
|
||||||||||| || |||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
1787835 |
gtttgttcagtcttggtttgtccgaatcttttcagatctcaggtgcatacgtcaaatgtagtcttaatccgaagaactatgtttttcaatggtaaaagtt |
1787934 |
T |
|
| Q |
111 |
atatt |
115 |
Q |
| |
|
||||| |
|
|
| T |
1787935 |
atatt |
1787939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University