View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12990_high_14 (Length: 269)
Name: NF12990_high_14
Description: NF12990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12990_high_14 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 3932484 - 3932216
Alignment:
| Q |
1 |
ctcaacccgttccatctctgctgggtcagctttccatcctctggatgctccaggaaatccaacacggaggattccatcctctgggtcaacacataatact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3932484 |
ctcaacccgttccatctctgctgggtcagctttccatcctctggatgctccaggaaatccaacacggaggattccatcctctgggtcaacacataatact |
3932385 |
T |
 |
| Q |
101 |
gtcccagtgctgtcacgtgactgcccacgccaaccaaacctaaaagaaacaatgatcatagaagttaaaggcaaatgggtgaaagcacacaaggcccaat |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3932384 |
gtcccaatgctgtcacgtgactgcccacgccaaccaaacctaaaagaaacaatgatcatcgaagttaaaggcaaatgggtgaaagcacacaaggcccgat |
3932285 |
T |
 |
| Q |
201 |
aaacaaaatttaacagaccagacataagttggcgtcctgtatataacttcttctgttcatttttagttg |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3932284 |
aaacaaaatttaacagaccagacataagttggcgtcctgtatataacttcttctgttcatttttagttg |
3932216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University