View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12990_high_19 (Length: 213)
Name: NF12990_high_19
Description: NF12990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12990_high_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 4625559 - 4625379
Alignment:
| Q |
18 |
aagattggaggaccaagcaactaacgatgcgacggtgaggacgaggaggagtttgggaaattcgtgcttcgatggaagcaaatttggaggtggttctttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4625559 |
aagattggaggaccaagcaactaacgatgcgacggtgaggacgaggaggagtttgggaaattcgtgcttcgatggaagcaaatttggaggtggttctttg |
4625460 |
T |
|
| Q |
118 |
tcgattattgatggtttcaatttgacttctcttgaacttttcccacttcgccggttcatcctcggaatcagatgacctatg |
198 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4625459 |
tcgattattgatgatttcaatttgacttctcttgaacttttcccacttcgccgattcatcctcggaatcagatgacctatg |
4625379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University