View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12990_low_18 (Length: 227)
Name: NF12990_low_18
Description: NF12990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12990_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 1163380 - 1163442
Alignment:
| Q |
1 |
caagtgtcatttatgaacttccacaaccctttcctttgttcctgggtgttaaatgcatacaca |
63 |
Q |
| |
|
||||||||||| ||||| || ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1163380 |
caagtgtcattaatgaattttcacaaccttttcctttgttcctgggtgttaaatgcatacaca |
1163442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 74
Target Start/End: Complemental strand, 40950794 - 40950725
Alignment:
| Q |
5 |
tgtcatttatgaacttccacaaccctttcctttgttcctgggtgttaaatgcatacacaaccaccaggtt |
74 |
Q |
| |
|
||||||| || || ||||||||||| ||||||||||| ||||| ||||||||||||||| | |||||||| |
|
|
| T |
40950794 |
tgtcattaataaatttccacaaccccttcctttgttcttgggttttaaatgcatacacagcaaccaggtt |
40950725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University