View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12990_low_18 (Length: 227)

Name: NF12990_low_18
Description: NF12990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12990_low_18
NF12990_low_18
[»] chr6 (1 HSPs)
chr6 (1-63)||(1163380-1163442)
[»] chr8 (1 HSPs)
chr8 (5-74)||(40950725-40950794)


Alignment Details
Target: chr6 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 1163380 - 1163442
Alignment:
1 caagtgtcatttatgaacttccacaaccctttcctttgttcctgggtgttaaatgcatacaca 63  Q
    ||||||||||| ||||| || ||||||| ||||||||||||||||||||||||||||||||||    
1163380 caagtgtcattaatgaattttcacaaccttttcctttgttcctgggtgttaaatgcatacaca 1163442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 74
Target Start/End: Complemental strand, 40950794 - 40950725
Alignment:
5 tgtcatttatgaacttccacaaccctttcctttgttcctgggtgttaaatgcatacacaaccaccaggtt 74  Q
    ||||||| || || ||||||||||| ||||||||||| ||||| ||||||||||||||| | ||||||||    
40950794 tgtcattaataaatttccacaaccccttcctttgttcttgggttttaaatgcatacacagcaaccaggtt 40950725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University