View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12990_low_8 (Length: 406)
Name: NF12990_low_8
Description: NF12990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12990_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 20 - 393
Target Start/End: Complemental strand, 18468346 - 18467973
Alignment:
| Q |
20 |
gtagccgatggttttgcttaactttcaaggattgggtgattgttgctgtattcggcaatagcggtccgatttgggggccttcagttttcgtcgatccatc |
119 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18468346 |
gtagccgatggttttgcttaactatcaaggattgggtgattgttgctgtattcggcaacagcggtccgatttgggggccttcagttttcgtcgatccatc |
18468247 |
T |
|
| Q |
120 |
tcgctcgttgtgtttggtggttcattgcgttgatgaaggttgtattggatggttttcaaatatagaaagaggcaaagtgccgtcgtgaatctcaactcat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18468246 |
tcgctcgttgtgtttggtggttcattgcgttgacgaaggttgtattggatggttttcaaatatagaaagaggcaaagtgccgtcgtgaatctcaactcat |
18468147 |
T |
|
| Q |
220 |
ggtggttttggtgtttgctttggttgttataacaatatttcttaaagtttcaggttgtcacttgattgttctctttggttgtgtggctggttcgttgttg |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18468146 |
ggtggttttggtgtttgctttggttgttataacaatatttcttaaagtttcaggttgtcacttgattgttctctttggttgtgtggctggttcgttgttg |
18468047 |
T |
|
| Q |
320 |
cggcttttaatggttcaatatggttctgaataggcaagaaattatcatttagcttcttgtttgtatgtcacagg |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| ||||| |
|
|
| T |
18468046 |
cggcttttaatggttcaatatggttctgaataggcaagaaattgtcatttagtttcttgtttgtatgttacagg |
18467973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University