View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12991_high_18 (Length: 437)
Name: NF12991_high_18
Description: NF12991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12991_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 63 - 414
Target Start/End: Complemental strand, 56313821 - 56313473
Alignment:
| Q |
63 |
aagctgagacagggaaaatggcgcccccgccgccaccacaagcggagactaacagagagtttcccgcagcagcatattgtactaggtgcctaggttgatg |
162 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
56313821 |
aagctgagacagggaaaatgacgcccccgccgccacca---gcggagactaacagagagtttcccgcagctgaatattgtactaggtgcctaggttgatg |
56313725 |
T |
 |
| Q |
163 |
ctgctgctgc---atcatcatcaatccttcttcctcttctgaacggtaattagtaggaggaggagtattgctatacttggaaagcccaagagttgttgtg |
259 |
Q |
| |
|
|||||||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56313724 |
ctgctgctgctgcataatcatcaatccttcttcttcttctgaacggtaattagtaggaggaggagtattgctatacttggaaagcccaagagttgttgtg |
56313625 |
T |
 |
| Q |
260 |
acatgatctgaattaccgccgctactgcttccttccattttgttaactatgtgatcatcaattgtctttggtgattgtccaacaacaaatcccattccca |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56313624 |
acatgatctgaattaccgccgctactgcttccttccattttgttaactatgtgatcatcaattgtctttggtgattgtccaacaacaaatcccattccca |
56313525 |
T |
 |
| Q |
360 |
atattttttcattttgctgcttattcttgtctgaatgtgaagcagtagtacctct |
414 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56313524 |
ata---tttcattttgctgcttattcttgtctgaatgtgaagcagtagtacctct |
56313473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University