View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12991_high_25 (Length: 353)
Name: NF12991_high_25
Description: NF12991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12991_high_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 19 - 341
Target Start/End: Complemental strand, 19236866 - 19236544
Alignment:
| Q |
19 |
ggtagtgaccctctttcagtatctctgtatcagatggacttagatagaaccttatttctattaaggtcatatcttcgcatccgcatcctgaaggtaatca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19236866 |
ggtagtgaccctctttcagtatctctgtatcagatggacttagatagaaccttatttctattaaggtcatatcttcgcatccgcatcctgaaggtaatca |
19236767 |
T |
 |
| Q |
119 |
gtcataagcttttagcttttacactcaaagcaatatgattatttatgggtgtttactgttaagtctaaattagttcatttgatagaaattaagaaaaacg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19236766 |
gtcataagcttttagcttttacactcaaagcaataggattatttatgggtgtttactattaagtctaaattagttcatttgatagaaattaagaaaaacg |
19236667 |
T |
 |
| Q |
219 |
aaccaataatttattgttgccttaccctcaagtattaacagcggccttattaatctttaactagattgaaatatgattttcggtatagcctctattttgc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19236666 |
aaccaataatttattgttgccttaccctcaagtattaacagcggccttattaatctttaactagattgaaatatgattttcggtatagcctctattttgc |
19236567 |
T |
 |
| Q |
319 |
gagataatattttttaccacctt |
341 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
19236566 |
gagataatattttttaccacctt |
19236544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University