View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12991_high_31 (Length: 293)
Name: NF12991_high_31
Description: NF12991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12991_high_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 9 - 274
Target Start/End: Complemental strand, 1457713 - 1457448
Alignment:
| Q |
9 |
ataagaaccgaaaacaacgaagggaatgcaaagtttcttgataagaagaaaagtagcaagttattacaatacggggttagccctgatcgtaatggagctt |
108 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1457713 |
ataagaactgaaaacaacgaagggaatgcaaagtttcttgataagaagaaaagtagcaagttattacaatacggggttagccctgatcgtaatggagctt |
1457614 |
T |
 |
| Q |
109 |
caaagaggaccacattgccttcggcgtgggcgctttcaccgggaaggaaatcccttggctctccgatttggtcagagtcaccgcctaaagcagtcggaag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1457613 |
caaagaggaccacattgccttcggcgtgggcgctttcaccgggaaggaaatcccttggctctccgatttggtcagagtcaccgcctaaagcagtcggaag |
1457514 |
T |
 |
| Q |
209 |
caacggtggcaatggtggtggtagagttggtaatagtgtcaataaagtcttgaattacttcaaaca |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1457513 |
caacggtggcaatggtggtggtagagttggtaatagtgtcaataaagtcttgaattacttcaaaca |
1457448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University