View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12991_high_42 (Length: 220)

Name: NF12991_high_42
Description: NF12991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12991_high_42
NF12991_high_42
[»] chr1 (1 HSPs)
chr1 (16-204)||(44643894-44644083)


Alignment Details
Target: chr1 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 16 - 204
Target Start/End: Original strand, 44643894 - 44644083
Alignment:
16 aagggaagtgaatattatgtgataaagtgatcatgtgttatttagggttgatgaaaacaaagaataatattaaagggnnnnnnn-tgcttactatttgtg 114  Q
    ||||||||||||||||||||||||||  ||||| |||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||    
44643894 aagggaagtgaatattatgtgataaaccgatcaagtgttatttagggttgatgaaaacaaagaataatattaaagggaaaaaaaatgcttactatttgtg 44643993  T
115 aataggcgcagttggtcggtcttttgctctcggcttcttgctgtgtgtttttaagtttgccatcaaagaactcctttatactaaatatat 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44643994 aataggcgcagttggtcggtcttttgctctcggcttcttgctgtgtgtttttaagtttgccatcaaagaactcctttatactaaatatat 44644083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University