View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12991_low_39 (Length: 250)
Name: NF12991_low_39
Description: NF12991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12991_low_39 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 53675915 - 53676152
Alignment:
| Q |
13 |
aatatatgcatgtaaaagtcaaccaattataatagaattcnnnnnnnnnnnngaagaaattataatagaattctaaggtcttcttctgctgccaaaaggg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53675915 |
aatatatgcatgtaaaagtcaaccaattataatagaattctttttcttttttgaagaaattataatagaattctaaggtcttcttctgctgccaaaaggg |
53676014 |
T |
|
| Q |
113 |
atagacttatggacgcccgagttcttctgtctgcccaaccttcattttctgtttgtactccgacaattctcttttgtacctttctttgtcccttaagcca |
212 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53676015 |
atagatttatggacgcccgagttcttctgtctgcccaaccttcattttctgtttgtactccgacaattctcttttgtacctttctttgtcccttaagcca |
53676114 |
T |
|
| Q |
213 |
atgttttggtaaatctgcaatattaggcgaacacacat |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53676115 |
atgttttggtaaatctgcaatattaggcgaacacacat |
53676152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University