View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12991_low_46 (Length: 220)
Name: NF12991_low_46
Description: NF12991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12991_low_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 16 - 204
Target Start/End: Original strand, 44643894 - 44644083
Alignment:
| Q |
16 |
aagggaagtgaatattatgtgataaagtgatcatgtgttatttagggttgatgaaaacaaagaataatattaaagggnnnnnnn-tgcttactatttgtg |
114 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44643894 |
aagggaagtgaatattatgtgataaaccgatcaagtgttatttagggttgatgaaaacaaagaataatattaaagggaaaaaaaatgcttactatttgtg |
44643993 |
T |
 |
| Q |
115 |
aataggcgcagttggtcggtcttttgctctcggcttcttgctgtgtgtttttaagtttgccatcaaagaactcctttatactaaatatat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44643994 |
aataggcgcagttggtcggtcttttgctctcggcttcttgctgtgtgtttttaagtttgccatcaaagaactcctttatactaaatatat |
44644083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University