View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12993_high_15 (Length: 346)
Name: NF12993_high_15
Description: NF12993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12993_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 19 - 339
Target Start/End: Original strand, 2829827 - 2830147
Alignment:
| Q |
19 |
ggttttagatccatcagaaagttggttgcgtccgttactatccctgaatctcttctcaatgctggttaatgcatcacctttcttctttatttcactcttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2829827 |
ggttttagatccatcagaaagttggttgcgtccgttactatccctgaatctcttctcaatgctggttaatgcatcacctttcttctttatttcactcttt |
2829926 |
T |
 |
| Q |
119 |
agctgggaaatttgctttcttagtttttctttctcagcctcatcctcaaaaagtgactttttcaaatcactgcattgaactctaatagcttccaactcag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2829927 |
agctgggaaatttgctttcttagtttttctttctcagcctcatcctcaaaaagtgactttttcaaatcactgcattgaactctaatagcttccaactcag |
2830026 |
T |
 |
| Q |
219 |
acttcaatagtctagcctcttcttctttttcttccttgaaatttctcattttacttagctcgttaagcgaatgttccgcttccttcttcaatgacgcaat |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2830027 |
acttcaatagtctagcctcttcttctttttcttccttgaaatttctcattttacttagctcgttaagcgaatgttccgcttccttcttcaatgacgcaat |
2830126 |
T |
 |
| Q |
319 |
tgtgctcacaagttcatctct |
339 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2830127 |
tgtgctcacaagttcatctct |
2830147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University