View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12993_high_16 (Length: 338)
Name: NF12993_high_16
Description: NF12993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12993_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 11 - 323
Target Start/End: Complemental strand, 3448904 - 3448592
Alignment:
| Q |
11 |
cagagaaggtgcagcgatgataaggattcaaggagaggtgaaaaattcaggtaacattgcgaaaactgtaatgcacgtaaggtgtttgatgaaagaatta |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3448904 |
cagagaaggtgcagcgatgataaggattcaaggagaggtgaaaaattcaggtaacattgcgaaaactgtaatgcatgtaaggtgtttgatgaaagaattg |
3448805 |
T |
 |
| Q |
111 |
agagtgcttagtaatatggatgacgatgaagttttcacgttttcgaagagaattcaagcgccttatgatattgttgcgcagacgaaacagatgggtagat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3448804 |
agagtgcttagtaatatggatgacgatgaagttttcacgttttcgaagagaattcaagcgccttatgatattgttgcgcagacgaaacagatgggtagat |
3448705 |
T |
 |
| Q |
211 |
tacctgttgtgcattttgctgccagtgggattgtgactccggcggacgcagcgttgatgatgcagttgggttgtcatggtgtgtttgtgggagcagaggt |
310 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3448704 |
tacctgttgtgcattttgctgccggtgggattgtgactcccgcggacgcggcgttgatgatgcagttgggttgtcatggtgtgtttgtgggagcagaggt |
3448605 |
T |
 |
| Q |
311 |
ttttggttatgag |
323 |
Q |
| |
|
||||||||||||| |
|
|
| T |
3448604 |
ttttggttatgag |
3448592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University