View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12994_high_1 (Length: 642)
Name: NF12994_high_1
Description: NF12994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12994_high_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 1e-42; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 40 - 219
Target Start/End: Original strand, 10353707 - 10353887
Alignment:
| Q |
40 |
atgtcaacatagtaggggtgtctctcatgctatgtgatgcttttgcattctatttgcttnnnnnnntgctcttaaatttaatttgatccgcctattcaaa |
139 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||| ||||||||||||||||||| || |||| |||||||||||| || ||||||||| |
|
|
| T |
10353707 |
atgtcaacatagtagggatgtctctcatgccatgtgatgtttttgcattctatttgcttaaaaaaatgttcttggatttaatttgattcgtctattcaaa |
10353806 |
T |
|
| Q |
140 |
taagaacatatccnnnnnnnnn-aagtgtaatatctttaacacctacactggttcttcttcaaaataatgacttttaaaac |
219 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10353807 |
taagaacatatcctttttcttttaagtgtaatatctttaacacctacactggttcttcttgaaaataatgacttttaaaac |
10353887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 517 - 609
Target Start/End: Original strand, 11825666 - 11825758
Alignment:
| Q |
517 |
attacttggtcgtattcttgaactttgagtttcttgacactaaccaatagaggatgatcatgttcagacatagcttggacctttagcatatat |
609 |
Q |
| |
|
||||||||||| |||| ||||| ||||||||||||||||||||||| |||||||| ||||| |||||| || ||||| | |||||||| |||| |
|
|
| T |
11825666 |
attacttggtcatattgttgaaatttgagtttcttgacactaaccagtagaggatcatcatattcagaaatggcttgaaactttagcacatat |
11825758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University