View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12994_high_12 (Length: 281)
Name: NF12994_high_12
Description: NF12994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12994_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 13772265 - 13772022
Alignment:
| Q |
1 |
tgtgaaacgtgaccgtgacctatggtttgagcttgatccttctgttgatctacttggtcttggtggtggtgctgctgct------tttaacaccccctct |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
13772265 |
tgtgaaacgtgaccgtgacctatggtttgagcttgatccttctgttgatctacttggtcttggtggtgctgctgctgctgctgcttttaacaccccctct |
13772166 |
T |
 |
| Q |
95 |
tccaaagagctaccacctcttagctttgagaaattcttctcatcagacaaaaaaggtacgtatatactttaccaaccactactatcactttcttgttcta |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13772165 |
tccaaagagctaccacctcttagctttgagaaattcttctcatcagacaataaaggtacgtatatactttaccaaccactactatcactttcttgttcta |
13772066 |
T |
 |
| Q |
195 |
ggttgttcttgttcccccaccactataccaatgtttttatccaa |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13772065 |
ggttgttcttgttcccccaccactataccaatgtttttatccaa |
13772022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University