View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12994_low_11 (Length: 359)
Name: NF12994_low_11
Description: NF12994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12994_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 134 - 342
Target Start/End: Complemental strand, 22778199 - 22777991
Alignment:
| Q |
134 |
tgtgtactctctgtatttaaatcagatgaataaaagcataacaacattaccctaaaacttttttacaaggtaatacaagctctaggttttaaggttctaa |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22778199 |
tgtgtactctctgtatttaaatcagatgaataaaagcataacaacattaccctaaaacttttttacaaggtaatacaagctctaggttttaaggttctaa |
22778100 |
T |
 |
| Q |
234 |
tataaagtggtctaaaatataacccgtttcacgaaccaatctgtttcataacctgtttttcaccgcataagatctgcagctgaagacaggcatcgacaac |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22778099 |
tataaagtggtctaaaatataacccgtttcacgaaccaatctgtttcataacctgtttttcaccgcataagacctgcagctgaagacaggcatcgacaac |
22778000 |
T |
 |
| Q |
334 |
ggttatcct |
342 |
Q |
| |
|
||||||||| |
|
|
| T |
22777999 |
ggttatcct |
22777991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 10 - 64
Target Start/End: Complemental strand, 22778325 - 22778271
Alignment:
| Q |
10 |
aagaatatgaggaaaaggatgaagattccgtgattgtctgtttgttaatagtgca |
64 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22778325 |
aagaaaatgaggaaaaagatgaagattccgtgattgtctgtttgttattagtgca |
22778271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University