View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12995_high_12 (Length: 370)
Name: NF12995_high_12
Description: NF12995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12995_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 23 - 360
Target Start/End: Complemental strand, 40648211 - 40647874
Alignment:
| Q |
23 |
gcaatccattttcccagtattggggagtcatttttctgacaagcatcaagggctcgttccaacatgggaagagtaggctctattgtcattgttttcataa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40648211 |
gcaatccattttcccagtattggggagtcatttttctgacaagcatcaagggctcgttccaacatgggaagagtaggctctattgtcattgttttcataa |
40648112 |
T |
 |
| Q |
123 |
aactctcgagctcatccatgtatccatgccgactatagagttcaatcatgcagccataatgctccaaccaaggcaggacgccgtattcattgctcataga |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40648111 |
aactctcgagctcatccatgtatccatgccgactatagagttcaatcatgcagccataatgctccaaccaaggcaggacaccgtattcattgctcataga |
40648012 |
T |
 |
| Q |
223 |
ctcgaagcattgagtgccaaactcaacaaggccttcttcaacacaagcaagaagaatgccctcaaaggtcacatggtctggcttgatgccttctgcttcc |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40648011 |
ctcgaagcattgagtgccaaactcaacaaggccttcttcaacacaagcaagaagaatgccctcaaaggtcacacggtctggcttgatgccttctgcttcc |
40647912 |
T |
 |
| Q |
323 |
attatcccaaaaagttcaagtgcatctcttcccctatg |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40647911 |
attatcccaaaaagttcaagtgcatctcttcccctatg |
40647874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University