View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12995_high_17 (Length: 266)
Name: NF12995_high_17
Description: NF12995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12995_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 256
Target Start/End: Original strand, 7290241 - 7290496
Alignment:
| Q |
1 |
aatgattatattccttatattcttgatgcaagttgatgataatcgtcttttggtatgttgggcagaattatgcacaaacatactttaggtaaaataaact |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7290241 |
aatgattatattccttgtattcttgatgcaagttgatgataatcgtcttttggtatgtttggcagaattatgcacaaacatactttaggtaaaataaact |
7290340 |
T |
|
| Q |
101 |
tatcttttatgtcttgcatggtagtgccttcaaggtccaagttatggttgatgtaaggttacattacagtgctattttgatttatagggagtgacaaacc |
200 |
Q |
| |
|
| ||||||||| |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
7290341 |
tgtcttttatgccttgcatggtggtgccttcaaggtccaagttatggttgatttaaggttacattacattattattttgatttatagggagtgacaaacc |
7290440 |
T |
|
| Q |
201 |
aaaaagttcattatatatagacataacaaatcacaatagaaaaatacggccctttg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7290441 |
aaaaagttcattatatatagacataacaaatcacaatagaaaaatatggccctttg |
7290496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University