View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12995_low_11 (Length: 371)
Name: NF12995_low_11
Description: NF12995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12995_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 1 - 355
Target Start/End: Original strand, 41912770 - 41913121
Alignment:
| Q |
1 |
tggatgttatttgttttgtacaatgttt-aagaattcttgatctgtgttaatgttttaatctttgtgctgtttagtgtttacttgttttaaatttgatac |
99 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41912770 |
tggatgttagttgttttgtacaatgttttaagaattcttgatctgtgttaatgttttaatctttgtgctgtttagtgtttacttgttttaaatttgatac |
41912869 |
T |
|
| Q |
100 |
gctatcactatcatgtttagattgtgtattaatataaataaggcatgtagcaagtaaatacagttgcctaaaatgaaaatgcaattgtcaaactaaagtt |
199 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41912870 |
gctatcattatcatgtttagattgtgtattaatataaataaggcatgcaacaagtaaatacagttgactaaaatgaaaatgcaattgtcaaactaaagtt |
41912969 |
T |
|
| Q |
200 |
ttgggtttatacacttcaatgaaaattatttgtttatgtctgttttaagaagtacctaattatgtttgggattgggattctggcgtcaaagttaccttaa |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41912970 |
ttgggtttatacacttcaatgaaaattatttgtttatgtctgttttaagaagtacc----tatgtttgggattgggattctggcgtcaaagttaccttaa |
41913065 |
T |
|
| Q |
300 |
ctttcaactcttataagccatcacatggatcttatgccacatgtaattttctctct |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41913066 |
ctttcaactcttataagccatcacatggatcttatgccacatgtaattctctctct |
41913121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University