View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12998_high_10 (Length: 319)
Name: NF12998_high_10
Description: NF12998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12998_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 19 - 313
Target Start/End: Original strand, 44676593 - 44676887
Alignment:
| Q |
19 |
cccataaccattttctcggtctctagtgtaggggtgggtggaagtgtaacaattgaagcaggttcacttttttggaaaacattttgggatatatatcgta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44676593 |
cccataaccattttctcggtctctagtgtaggggtgggtggaagtgtaacaattgaagcaggttcacttttttggaaaacattttgggatatatatcgta |
44676692 |
T |
 |
| Q |
119 |
tgttcttcttcatagcccatcgactagttctaccacctttacgtttgggaggtgtatccactatgattccttcttctgatggaatctctatatctttgat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44676693 |
tgttcttcttcatagcccatcgactagttctaccacctttacgtttgggaggtgtatccactatgattccttcttctgatggaatctctatctctttgat |
44676792 |
T |
 |
| Q |
219 |
attattataatttgttgttgatgttcctcggaagctgtaaacttttctactcaagtgtgagttccagtagtttttaatctcgttgtctgtgctgc |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44676793 |
attattataatttgttgttgatgttcctcggaagctgtaaacttttctactcaagtgtgagttccagtagtttttaatctcgttgtctgttctgc |
44676887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University