View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12998_low_13 (Length: 265)

Name: NF12998_low_13
Description: NF12998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12998_low_13
NF12998_low_13
[»] chr6 (1 HSPs)
chr6 (8-131)||(1273723-1273846)


Alignment Details
Target: chr6 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 8 - 131
Target Start/End: Complemental strand, 1273846 - 1273723
Alignment:
8 tgaaatgaaggaagtatgattagagagtatttttgtaaatttattttttattatgtagtcatctctagtgattagatctaataaataatcacgtgtaaat 107  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |||||    
1273846 tgaaatgaaggaagtatgattagagggtatttttgtaaatttattttttattatgcagtcatctctagtgattagatctaataaataatcacctctaaat 1273747  T
108 ttatatagacaatcaaacatcttg 131  Q
    |||||  |||||||||||||||||    
1273746 ttatacggacaatcaaacatcttg 1273723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University