View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12998_low_13 (Length: 265)
Name: NF12998_low_13
Description: NF12998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12998_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 8 - 131
Target Start/End: Complemental strand, 1273846 - 1273723
Alignment:
| Q |
8 |
tgaaatgaaggaagtatgattagagagtatttttgtaaatttattttttattatgtagtcatctctagtgattagatctaataaataatcacgtgtaaat |
107 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
1273846 |
tgaaatgaaggaagtatgattagagggtatttttgtaaatttattttttattatgcagtcatctctagtgattagatctaataaataatcacctctaaat |
1273747 |
T |
 |
| Q |
108 |
ttatatagacaatcaaacatcttg |
131 |
Q |
| |
|
||||| ||||||||||||||||| |
|
|
| T |
1273746 |
ttatacggacaatcaaacatcttg |
1273723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University