View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12998_low_7 (Length: 403)
Name: NF12998_low_7
Description: NF12998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12998_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 374; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 374; E-Value: 0
Query Start/End: Original strand, 6 - 387
Target Start/End: Original strand, 49065078 - 49065459
Alignment:
| Q |
6 |
agaagcaaaggaggcaaaggtagatacttcatttgatctgaatgttcctaacaatgattgtgatcttgggtgcaattcaaagtcaaatttagttacatgt |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49065078 |
agaagaaaaggaggcaaaggtagatacttcatttgatctgaatgttcctaacaatgattgtgatcttgggtgcaattcaatgtcaaatttagttacatgt |
49065177 |
T |
|
| Q |
106 |
ttggacatagataattcttctaaaacatcctcagaaaatttcacttgtggctctgaatcaacttcagagccacgttttttcacttgcaactactgcaaga |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49065178 |
ttggacatagataattcttctaaaacatcctcagaaaatttcacttgtggctctgaatcaacttcagagccacgttttttcacttgcaactactgcaaga |
49065277 |
T |
|
| Q |
206 |
gaaaattcttcagttcacaagcacttgggggacatcaaaatgctcacaagagagagaggtcaattgcaaaaagaggacggaggacgatgttctcagcaac |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49065278 |
gaaaattcttcagttcacaagcacttgggggacatcaaaatgctcacaagagagagaggtcaattgcaaaaagaggacggaggacgatgttctcagcaac |
49065377 |
T |
|
| Q |
306 |
aggaacaacctcatttcttcataatcatcttcaccaccgttatgcaaatatggcatctctactaccactctatggtgctaac |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49065378 |
aggaacaacctcatttcttcataatcatcttcaccaccgttatgcaaatatggcatctctactaccactctatggtgctaac |
49065459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 205 - 283
Target Start/End: Complemental strand, 2867194 - 2867116
Alignment:
| Q |
205 |
agaaaattcttcagttcacaagcacttgggggacatcaaaatgctcacaagagagagaggtcaattgcaaaaagaggac |
283 |
Q |
| |
|
|||||||||| || ||||||||| | || ||||| |||||||||||||| |||||||| ||||| ||||||||||||| |
|
|
| T |
2867194 |
agaaaattctatagctcacaagcattaggtggacaccaaaatgctcacaaaagagagagatcaatagcaaaaagaggac |
2867116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University