View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12998_low_8 (Length: 354)
Name: NF12998_low_8
Description: NF12998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12998_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 338
Target Start/End: Original strand, 38022153 - 38022501
Alignment:
| Q |
1 |
ataggttattatttttgcgaattcataagttttgttttccaaatcataaaatatcattcaaataatttatttattcacgttgatttaatatcattgtcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38022153 |
ataggttattatttttgcgaattcataagttttgttttccaaaccataaattatcattcaaataatttatttattcacgttgatttaatatcattgtcaa |
38022252 |
T |
 |
| Q |
101 |
tttactatttgtctatgaaatttggactattcaatgatgattgttctacggt------------ctcaaaaacccttcaaatttattggactttaatccc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38022253 |
tttactatttgtctatgaaatttggactattcaatggtgattgttctacgatcccctcagtcagctcaaaaacccttcaaatttattggactttaatccc |
38022352 |
T |
 |
| Q |
189 |
gatcacccaaacctattnnnnnnntatgatttgattagtgnnnnnnngcatcggaccataactattgatgacttatttcaaatgtcaaacaatttacatc |
288 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||| ||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
38022353 |
gatcacccaaacctatt-aaaaaatatgaattgattagtgtttttttgcatcggaccataactattgatgacttatttcaaaggtcgaacaatttacatc |
38022451 |
T |
 |
| Q |
289 |
gtacaatatcagaaagaggcggctcaaagtcgtgctacgacacaacaatg |
338 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38022452 |
gtacaagatcagaaagaggcggctcaaagtcgtgctacgacacaacaatg |
38022501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University