View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12999_high_20 (Length: 248)
Name: NF12999_high_20
Description: NF12999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12999_high_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 46 - 231
Target Start/End: Complemental strand, 29097365 - 29097180
Alignment:
| Q |
46 |
atattctgaactgcgggataaatggtgcatttggatcaacttataaacaatttatttgggcttagctaccgacatatgcacttgtatgagtgtatgaaaa |
145 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29097365 |
atattctggactgcgggataaatggtgcatttggatcaacttataaacaatttatttgggcttagctaccgacatatgcacttgtatgagtgtatgaaaa |
29097266 |
T |
|
| Q |
146 |
aacttatgaaaataacgtatgacatatctataagctggttgtagagtattacaatgatctctttaggataactgatggaacagttt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||| |
|
|
| T |
29097265 |
aacttatgaaaataacgtatgacatatctataagctggttgtagagtatttcaatgatctcattaggataaccgatggaacagttt |
29097180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University