View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12999_low_10 (Length: 371)
Name: NF12999_low_10
Description: NF12999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12999_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 19 - 362
Target Start/End: Complemental strand, 29994017 - 29993674
Alignment:
| Q |
19 |
taggaagggtgttatatttgcatgaaggattggcaaaggtgcatacagaaaatacggccaatcatatccaacttgactttaacactgttaagctaaaaat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29994017 |
taggaagggtgttatatttgcatgaaggattggcaaaggtgcatacagaaaatacggccaatcatatccaacttgactttaacactgttgagctaaaaat |
29993918 |
T |
 |
| Q |
119 |
attactttgaatttagggtctatgttatacttaaagcctcttataaatccgtgaagccatttctttgcaaaaggatttgtagacatgatttgtatgctct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29993917 |
attactttgaatttagggtctatgttatacttaaagcctcttataaatccgtgaagccatttctttgcaaaaggatttgtagacatgatttgtatgctct |
29993818 |
T |
 |
| Q |
219 |
agctttagggaatgctggaaagtatcttctattcagtgaaagtattttccatttaggggctgcagataactatgatttgacttgtaatgtttttctgttc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29993817 |
agctttagggaatgctggaaagtatcttctattcagtgaaagtattttccatttaggggctgcagataactatgatttgacttgtaatgtttttctgttc |
29993718 |
T |
 |
| Q |
319 |
cttatttcttttattttcgtatacatgtaattaatcatgatgat |
362 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
29993717 |
cttatttcttttattttcttatacatctaattaatcatgatgat |
29993674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University