View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12999_low_15 (Length: 299)
Name: NF12999_low_15
Description: NF12999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12999_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 50 - 285
Target Start/End: Original strand, 35213188 - 35213419
Alignment:
| Q |
50 |
ggaaagattgagaacgagaaaccaaggagaaaaatctgcgtgctgccatgatagaaaaagattgttaccaacttaggctcagtggcattgttttgttcta |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35213188 |
ggaaagattgagaacgagaaaccaaggagaaaaatctgcgtgctgccatgatagaaaaagattgttaccaacttaggctcagtggcattgttttgttcta |
35213287 |
T |
|
| Q |
150 |
cttagtataaataattaagtattagtacaatatttttattttatttcaaaagaatgctgaatcatgcatgtttcctataaacaaaacaacaaaagtcata |
249 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35213288 |
cttagtataaataa----gtattagtacaatatttttattttatttcaaaagaatgctgaatcatgcatgtttcccataaacaaaacaacaaaagtcata |
35213383 |
T |
|
| Q |
250 |
gtttggtttcttcgtgtcatcctcctttaattttat |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
35213384 |
gtttggtttcttcgtgtcatcctcctttaattttat |
35213419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 11 - 50
Target Start/End: Original strand, 35213116 - 35213155
Alignment:
| Q |
11 |
cataggtgattagtgataattttctgtcacctaatgtatg |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35213116 |
cataggtgattagtgataattttctgtcacctaatgtatg |
35213155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University