View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12999_low_18 (Length: 264)
Name: NF12999_low_18
Description: NF12999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12999_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 14 - 257
Target Start/End: Complemental strand, 52987690 - 52987446
Alignment:
| Q |
14 |
catcatgatcttgatacagggaccagaattgtgggatgaatagatgatagttttttatgcaaacatttctttgtttagtgcatcttgccnnnnnnnnnnn |
113 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52987690 |
catcttgatcttgatacagggaccagaattgtgggatgaatagatgatagttttttatgcaaacatttctttgtttagtgcatcttgccttttttttttt |
52987591 |
T |
|
| Q |
114 |
nnnn-agattggagctaaggatgtcnnnnnnnnnnnnnnttactttcttcatcatttaataagcacgaaatgacaaaccgaatcaactagacctaatcac |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52987590 |
tttttagattggagctaaggatgtcaaaaaaataaaaaattactttcttcatcatttaataagcacgaaatgacaaaccgaatcaactaagcctaatcac |
52987491 |
T |
|
| Q |
213 |
acttttaaccttcatgtttctcaatctaaaaaattttcactcata |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52987490 |
acttttaaccttcatgtttctcaatctaaaaaattttcactcata |
52987446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University