View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12999_low_9 (Length: 381)
Name: NF12999_low_9
Description: NF12999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12999_low_9 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 2e-65; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 251 - 381
Target Start/End: Original strand, 52987302 - 52987432
Alignment:
| Q |
251 |
gtatactagtatccacattgccaaagtgacaaggatgccacgtcactaaaactcaccacctcatcgtcaaattggggaaagttttgtgagggaccttgaa |
350 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52987302 |
gtatactagtatccacattggcaaagtgacaaggatgccacgtcactaaaactcaccacctcatcgtcaaattggggaaagttttgtgagggaccttgaa |
52987401 |
T |
 |
| Q |
351 |
atcaaaaaagaaataaatgtggggtttaaat |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
52987402 |
atcaaaaaagaaataaatgtggggtttaaat |
52987432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 15 - 106
Target Start/End: Original strand, 52987090 - 52987181
Alignment:
| Q |
15 |
catagggctaggcaaacaccaattgaaggtgaaaatgatgatttgggaattgaaagcaaaaccctaatttaagattcagaattaacagactt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52987090 |
catagggctaggcaaacaccaattgaaggtgaaaatgatgatttgggaattgaaagcaaaaccctaatttaagattcagaattaacagactt |
52987181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 145 - 187
Target Start/End: Original strand, 52987196 - 52987238
Alignment:
| Q |
145 |
atttatataggttttggtgtcaagaaggtgggacccggattct |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52987196 |
atttatataggttttggtgtcaagaaggtgggacccggattct |
52987238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University