View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1299R-Insertion-11 (Length: 169)
Name: NF1299R-Insertion-11
Description: NF1299R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1299R-Insertion-11 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr3 (1 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 4e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 4e-86
Query Start/End: Original strand, 9 - 169
Target Start/End: Original strand, 50756352 - 50756512
Alignment:
| Q |
9 |
gatagtgactcagttcttaggctcaatcactacccacctacacttaacaaggacaagtcacattccaacaatgttggctttggggagcattctgaccctc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50756352 |
gatagtgactcagttcttaggctcaatcactacccacctacacttaacaaggacaagtcacattccaacaatgttggctttggggagcattctgaccctc |
50756451 |
T |
|
| Q |
109 |
agatcttgaccattcttagatctaatgacgtttctggtcttcaaatttctcttcaacatgg |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50756452 |
agatcttgaccattcttagatctaatgacgtttctggtcttcaaatttctcttcaacatgg |
50756512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 4320417 - 4320367
Alignment:
| Q |
119 |
cattcttagatctaatgacgtttctggtcttcaaatttctcttcaacatgg |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4320417 |
cattcttagatctaatgacgtttctggtcttcaaatttctcttcaacatgg |
4320367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000006
Query Start/End: Original strand, 70 - 169
Target Start/End: Complemental strand, 12610491 - 12610392
Alignment:
| Q |
70 |
attccaacaatgttggctttggggagcattctgaccctcagatcttgaccattcttagatctaatgacgtttctggtcttcaaatttctcttcaacatgg |
169 |
Q |
| |
|
||||| |||| ||||||||||| || ||||||||||||||||| | || || |||||||| || || ||| ||||||| |||||||| ||||||||||| |
|
|
| T |
12610491 |
attcctacaacgttggctttggagaacattctgaccctcagattcttactatccttagatccaacgatgttgctggtctccaaatttcacttcaacatgg |
12610392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University