View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1299R-Insertion-7 (Length: 325)
Name: NF1299R-Insertion-7
Description: NF1299R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1299R-Insertion-7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 7e-83; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 9 - 199
Target Start/End: Complemental strand, 30438701 - 30438506
Alignment:
| Q |
9 |
gaacttgtggcgaagttctcttcatcgagaaagcataaactgtatccgtcaggtttaaccttaattttatttatgctcggttgtagaacttgtggaaaat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30438701 |
gaacttgtggcgaagttctcttcatcgagaaagcataaactgtatccgtcaggtttaaccttaattttatttatactcggttgtagaacttgtggaaaat |
30438602 |
T |
|
| Q |
109 |
ttctcttacatgaggtg-----aactgtattcgttttgggatgtaggttttacctaaattgtatttatactaggttgttgaacttgtggcaaagtt |
199 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
30438601 |
ttctcttacctgaggtggcataaactgtattcgttttgggatgtaggttttacctaaattgtatttatgctcggttgtggaacttgtggcaaagtt |
30438506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 262 - 325
Target Start/End: Complemental strand, 30438535 - 30438472
Alignment:
| Q |
262 |
atgctcggttgtggaacttgtggcaaagttctcttatccgagatggcgtattacctaatttatg |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30438535 |
atgctcggttgtggaacttgtggcaaagttcttttatccgagatggcgtattacctaatttatg |
30438472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 59 - 112
Target Start/End: Complemental strand, 30438557 - 30438504
Alignment:
| Q |
59 |
aggtttaaccttaattttatttatgctcggttgtagaacttgtggaaaatttct |
112 |
Q |
| |
|
|||||| |||| |||| ||||||||||||||||| |||||||||| ||| |||| |
|
|
| T |
30438557 |
aggttttacctaaattgtatttatgctcggttgtggaacttgtggcaaagttct |
30438504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University