View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1299R-Insertion-9 (Length: 191)
Name: NF1299R-Insertion-9
Description: NF1299R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1299R-Insertion-9 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 9 - 191
Target Start/End: Original strand, 10975974 - 10976156
Alignment:
| Q |
9 |
gattcaagctttttgattgattgtttctcacgtttggcgaattgttttgattctctgcatggtgttagaccggagatgtcggcgacagcggggagtggtg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10975974 |
gattcaagctttttgattgattgtttctcacgtttggcgaattgttttgattctctgcatggtgttaggccggagatgtcggcgacagcggggagtggtg |
10976073 |
T |
 |
| Q |
109 |
atgagatgaggattgatgagagtgctagtgctgctgagaatgcttttagatttgagtttacatcgttgcttggtttttcttgg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10976074 |
atgagatgaggattgatgagagtgctagtgctgctgagaatgcttttagatttgagtttacatcgttggttggtttttcttgg |
10976156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University