View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1299_1D_high_15 (Length: 269)
Name: NF1299_1D_high_15
Description: NF1299_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1299_1D_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 23 - 266
Target Start/End: Original strand, 10975974 - 10976217
Alignment:
| Q |
23 |
gattcaagctttttgattgattgtttctcacgtttggcgaattgttttgattctctgcatggtgttagaccggagatgtcggcgacagcggggagtggtg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10975974 |
gattcaagctttttgattgattgtttctcacgtttggcgaattgttttgattctctgcatggtgttaggccggagatgtcggcgacagcggggagtggtg |
10976073 |
T |
 |
| Q |
123 |
atgagatgaggattgatgagagtgctagtgctgctgagaatgcttttagatttgagtttacatcgttgcttggtttttcttggtttgtgctgcagtggat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10976074 |
atgagatgaggattgatgagagtgctagtgctgctgagaatgcttttagatttgagtttacatcgttggttggtttttcttggtttgtgctgcagtggat |
10976173 |
T |
 |
| Q |
223 |
gatgttggttgagagttttggtttttgaggtagttttggtctta |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10976174 |
gatgttggttgagagttttggtttttgaggtaattttggtctta |
10976217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University