View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1299_1D_high_17 (Length: 259)
Name: NF1299_1D_high_17
Description: NF1299_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1299_1D_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 25 - 244
Target Start/End: Original strand, 50756352 - 50756571
Alignment:
| Q |
25 |
gatagtgactcagttcttaggctcaatcactacccacctacacttaacaaggacaagtcacattccaacaatgttggctttggggagcattctgaccctc |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50756352 |
gatagtgactcagttcttaggctcaatcactacccacctacacttaacaaggacaagtcacattccaacaatgttggctttggggagcattctgaccctc |
50756451 |
T |
 |
| Q |
125 |
agatcttgaccattcttagatctaatgacgtttctggtcttcaaatttctcttcaacatggtctctggattcctgttaaccctgacccagaagctctatg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50756452 |
agatcttgaccattcttagatctaatgacgtttctggtcttcaaatttctcttcaacatggtctctggattcctgttaaccctgacccagaagctctatg |
50756551 |
T |
 |
| Q |
225 |
tattaatataggtgatgtcc |
244 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
50756552 |
tattaatataggtgatgtcc |
50756571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 135 - 244
Target Start/End: Complemental strand, 4320417 - 4320308
Alignment:
| Q |
135 |
cattcttagatctaatgacgtttctggtcttcaaatttctcttcaacatggtctctggattcctgttaaccctgacccagaagctctatgtattaatata |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4320417 |
cattcttagatctaatgacgtttctggtcttcaaatttctcttcaacatggtctctggattcctgttaaccctgacccagaagctctatgtgttaatata |
4320318 |
T |
 |
| Q |
235 |
ggtgatgtcc |
244 |
Q |
| |
|
|||||||||| |
|
|
| T |
4320317 |
ggtgatgtcc |
4320308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 86 - 186
Target Start/End: Complemental strand, 12610491 - 12610391
Alignment:
| Q |
86 |
attccaacaatgttggctttggggagcattctgaccctcagatcttgaccattcttagatctaatgacgtttctggtcttcaaatttctcttcaacatgg |
185 |
Q |
| |
|
||||| |||| ||||||||||| || ||||||||||||||||| | || || |||||||| || || ||| ||||||| |||||||| ||||||||||| |
|
|
| T |
12610491 |
attcctacaacgttggctttggagaacattctgaccctcagattcttactatccttagatccaacgatgttgctggtctccaaatttcacttcaacatgg |
12610392 |
T |
 |
| Q |
186 |
t |
186 |
Q |
| |
|
| |
|
|
| T |
12610391 |
t |
12610391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University