View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1299_1D_high_19 (Length: 202)
Name: NF1299_1D_high_19
Description: NF1299_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1299_1D_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 9 - 187
Target Start/End: Complemental strand, 21592882 - 21592703
Alignment:
| Q |
9 |
gatatgaaggttcaaggagaaagcctaacagatatgacttgcacaatcgccgatgggaatgggaagatgctcctcaaagggaagaaactccatggcatac |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21592882 |
gatatgaaggttcaaggagaaagcctaacagatatgacttgcacaatcgccgatgggaatgggaagatgctcctcaaagggaagaaactccatggcatac |
21592783 |
T |
 |
| Q |
109 |
tccttgttcgtcctttaattcactttctcctttggatcatgtttctccgtctcc-tttccaatacgggcttctgtctctt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
21592782 |
tccttgttcgtcctttaattcactttctcctttggatcatgtttctccgtctccttttccaatacgggcttctggctctt |
21592703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 124 - 179
Target Start/End: Original strand, 42095134 - 42095190
Alignment:
| Q |
124 |
taattcactttctcctttggatcatgtttctccgtctcct-ttccaatacgggcttc |
179 |
Q |
| |
|
|||||||| |||||||| ||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
42095134 |
taattcaccttctccttgggaccatgtttctccgtctcctgttccaatacgagcttc |
42095190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University