View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1299_1D_high_19 (Length: 202)

Name: NF1299_1D_high_19
Description: NF1299_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1299_1D_high_19
NF1299_1D_high_19
[»] chr3 (1 HSPs)
chr3 (9-187)||(21592703-21592882)
[»] chr2 (1 HSPs)
chr2 (124-179)||(42095134-42095190)


Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 9 - 187
Target Start/End: Complemental strand, 21592882 - 21592703
Alignment:
9 gatatgaaggttcaaggagaaagcctaacagatatgacttgcacaatcgccgatgggaatgggaagatgctcctcaaagggaagaaactccatggcatac 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21592882 gatatgaaggttcaaggagaaagcctaacagatatgacttgcacaatcgccgatgggaatgggaagatgctcctcaaagggaagaaactccatggcatac 21592783  T
109 tccttgttcgtcctttaattcactttctcctttggatcatgtttctccgtctcc-tttccaatacgggcttctgtctctt 187  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||    
21592782 tccttgttcgtcctttaattcactttctcctttggatcatgtttctccgtctccttttccaatacgggcttctggctctt 21592703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 124 - 179
Target Start/End: Original strand, 42095134 - 42095190
Alignment:
124 taattcactttctcctttggatcatgtttctccgtctcct-ttccaatacgggcttc 179  Q
    |||||||| |||||||| ||| |||||||||||||||||| |||||||||| |||||    
42095134 taattcaccttctccttgggaccatgtttctccgtctcctgttccaatacgagcttc 42095190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University