View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1299_1D_low_13 (Length: 313)
Name: NF1299_1D_low_13
Description: NF1299_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1299_1D_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 1e-78; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 13651504 - 13651344
Alignment:
| Q |
1 |
ttaaaagaagttcagctagcatgagcattgtgtttacatggccttgtgctggacatgggaagattaacacatgcggtgtttccatttttctacaatctca |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13651504 |
ttaaaagaagttcagctagcttgagcattgtgtttacatggccttgtgctggacatgggaagattaacacatgcggtgtttccatttttcaacaatctca |
13651405 |
T |
|
| Q |
101 |
attttgtgatctataggataagataagatgctatttggtagtagcattttatagtgtttgt |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13651404 |
attttgtgatctataggataagataagatgctatttggtagtagctttttatagtgtttgt |
13651344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 5 - 73
Target Start/End: Complemental strand, 13646422 - 13646354
Alignment:
| Q |
5 |
aagaagttcagctagcatgagcattgtgtttacatggccttgtgctggacatgggaagattaacacatg |
73 |
Q |
| |
|
|||||||||||||||| | ||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13646422 |
aagaagttcagctagctttagcattgaatttacatggccttgtgctggacatgggaagattagcacatg |
13646354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 5 - 73
Target Start/End: Complemental strand, 13656748 - 13656680
Alignment:
| Q |
5 |
aagaagttcagctagcatgagcattgtgtttacatggccttgtgctggacatgggaagattaacacatg |
73 |
Q |
| |
|
|||||||||||||||| | ||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13656748 |
aagaagttcagctagctttagcattggatttacatggccttgtgctggacatgggaagattagcacatg |
13656680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 207 - 289
Target Start/End: Complemental strand, 13651305 - 13651223
Alignment:
| Q |
207 |
tactagtattatggatcttggtaaccagtatcctcagggcaatggtttaggaaactaaaaggagcaaatagtcactttagtcc |
289 |
Q |
| |
|
||||||||||||||||||| | || | | |||||| |||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
13651305 |
tactagtattatggatcttactgacgaatgtcctcatggcaatggttaaggaaactaaaatgagcaaatagtcactttagtcc |
13651223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 262 - 292
Target Start/End: Original strand, 41753990 - 41754020
Alignment:
| Q |
262 |
taaaaggagcaaatagtcactttagtccctg |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41753990 |
taaaaggagcaaatagtcactttagtccctg |
41754020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 228 - 266
Target Start/End: Original strand, 33474296 - 33474334
Alignment:
| Q |
228 |
taaccagtatcctcagggcaatggtttaggaaactaaaa |
266 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
33474296 |
taaccagtatcatcagggcaatggttaaggaaactaaaa |
33474334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 222 - 267
Target Start/End: Original strand, 19645948 - 19645993
Alignment:
| Q |
222 |
tcttggtaaccagtatcctcagggcaatggtttaggaaactaaaag |
267 |
Q |
| |
|
||||| |||||| | ||||||||||||||||| ||||||||||||| |
|
|
| T |
19645948 |
tcttgctaaccattgtcctcagggcaatggttaaggaaactaaaag |
19645993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 262 - 294
Target Start/End: Original strand, 36278944 - 36278976
Alignment:
| Q |
262 |
taaaaggagcaaatagtcactttagtccctgat |
294 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
36278944 |
taaatggagcaaatagtcactttagtccctgat |
36278976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 266
Target Start/End: Complemental strand, 12173290 - 12173238
Alignment:
| Q |
214 |
attatggatcttggtaaccagtatcctcagggcaatggtttaggaaactaaaa |
266 |
Q |
| |
|
||||||| ||||| |||||||| |||||||| ||||||| |||||||||||| |
|
|
| T |
12173290 |
attatgggtcttgttaaccagtgccctcagggtaatggttaaggaaactaaaa |
12173238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University