View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1299_1D_low_18 (Length: 266)
Name: NF1299_1D_low_18
Description: NF1299_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1299_1D_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 17 - 239
Target Start/End: Original strand, 8739214 - 8739434
Alignment:
| Q |
17 |
gttttcataaaaagaaattgttctattggtgacttgatttgttttggtactacttacttgtacgaatataaagtgaatattgattatcctctctg-ggtg |
115 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8739214 |
gttttcataaaatgaaattgttctattggtgacttgatttgttttggtact---tacttgtacgaatataaagtgaatattgattatcctctctgaggtg |
8739310 |
T |
|
| Q |
116 |
atagaccataaattgtattccatgaacattcacgcacgatttagatcggaaaatattttcaagctcgattaagatcgggaaaaattaaatttgaatatgg |
215 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8739311 |
atagatcataaattgtattccatgaacattcacgcacgatttagatcggaaaatattttcaagctcgattaagatcgggaaaaattaaatttgaatatgg |
8739410 |
T |
|
| Q |
216 |
aactgtctgatcttcattaaacaa |
239 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
8739411 |
aactgtctgatcttcattaaacaa |
8739434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University