View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1299_1D_low_25 (Length: 221)
Name: NF1299_1D_low_25
Description: NF1299_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1299_1D_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 9 - 210
Target Start/End: Complemental strand, 43363248 - 43363047
Alignment:
| Q |
9 |
aacacgattttgaatatgattatccacaaatttcatgtgttcaaatatacatttcattattcgtcaaaattatgttcaagtctaggtgatctccaggtgt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43363248 |
aacacgattttgaatatgattatccacaaatttcatgtgttcaaatatacatttcattattcgtcaaaattatgttcaagtctaggtgatctccaggtgt |
43363149 |
T |
 |
| Q |
109 |
tcaaaccttaaattcagatgatattcattaccacaatcttgagtacaaatacacacttgcaaattgtagttaataacgttcaaagtcatggtaaattata |
208 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43363148 |
tcaaactttaaattcagatgatattcattaccacgatcttgagtacaaatacacacttgcaaattgtagttaataacgttcaaagtcattgtaaattata |
43363049 |
T |
 |
| Q |
209 |
tt |
210 |
Q |
| |
|
|| |
|
|
| T |
43363048 |
tt |
43363047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University